If you have been reading about PPARδ and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2026-01-10. Where a claim depends on a specific study, the study is described rather than over-claimed.
Laboratory detection of cardarine typically involves sample preparation followed by chromatographic separation and mass spectrometric identification. Urine is the most common matrix for anti-doping tests, though blood and hair have also been explored. Methods can target the parent compound or its metabolites, depending on the expected window of detection. Reference standards are required for accurate quantification. Matrix effects and dilution can influence results, so laboratories use internal standards and validation protocols. The exact detection window varies with dose, route, and individual metabolism.
A common misconception is that cardarine has been proven safe for human use. In reality, human clinical data are limited, and long-term animal studies have raised concerns about cancer. Another misconception is that it is a supplement or vitamin-like compound. It is a synthetic research chemical with no approved medical indication. Scientific discussion often focuses on its mechanism and detection rather than therapeutic use. Regulatory and anti-doping literature treats it primarily as a prohibited substance.
Quality assessment for cardarine samples usually combines identity, purity, and impurity testing. Nuclear magnetic resonance spectroscopy and mass spectrometry can confirm molecular structure, while high-performance liquid chromatography estimates purity. Certificates of analysis from testing laboratories may list these results, but they do not establish safety or legality. In the absence of approved manufacturing, products sold online may contain the wrong compound, variable amounts, or unlisted contaminants. Independent verification is therefore central to analytical work and to interpreting any reported biological activity.
Laboratory detection of GW501516 commonly uses liquid chromatography coupled with tandem mass spectrometry. The method can identify the parent compound or its metabolites in urine and blood after sample cleanup. Protein precipitation, solid-phase extraction, or enzymatic hydrolysis may precede analysis, depending on the matrix. Reference standards are required for accurate quantification and confirmation. Because the compound is not approved, testing often occurs in anti-doping, forensic, or research settings rather than routine clinical care. Results are reported with limits of detection and quantification.
Stability of GW501516 depends on form, temperature, light exposure, and moisture. Solid reference material is typically stored frozen or refrigerated in a desiccator and protected from light. Solutions in organic solvents such as dimethyl sulfoxide are often kept frozen in aliquots to reduce freeze-thaw cycling. Aqueous solubility is low, so aqueous stock solutions can be difficult to prepare without cosolvents. Degradation may appear as changes in chromatographic purity or mass spectral signal. Stability studies are needed to establish shelf life for any specific preparation.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Prohibited in sport | Listed by WADA as a PPARδ agonist. |
| Typical detection matrix | Urine | Most common sample for anti-doping analysis. |
| Common analytical method | LC-MS/MS | Liquid chromatography-tandem mass spectrometry. |
| Common synonyms | GW501516, GSK-516, endurobol | Names found in research and fitness contexts. |
| Typical detection window | Variable | Depends on dose, route, and individual metabolism. |
Literature on cardarine often separates receptor pharmacology from toxicology. Mechanistic papers describe PPARδ activation and gene expression changes, while safety assessments focus on carcinogenicity and species differences. Questions remain about whether rodent tumors arise through PPARδ-dependent or off-target mechanisms. Another open area is how human metabolism and exposure compare with those in animal studies. Analytical methods such as liquid chromatography–mass spectrometry are used to confirm identity in biological and product samples.
GW501516 acts as an agonist at the peroxisome proliferator-activated receptor delta, a nuclear receptor that regulates gene expression. Activation shifts transcription toward genes involved in fatty acid uptake, oxidation, and energy expenditure. The compound does not bind the androgen receptor and therefore differs from anabolic steroids and SARMs. In rodent models, this metabolic shift has been linked to increased running endurance and reduced fat accumulation. The exact downstream pathways in humans remain incompletely characterized.
Regulatory treatment varies, but cardarine is not approved as a medicine. Sports authorities list GW501516 as a prohibited substance, and it is banned at all times under the World Anti-Doping Agency code. Many countries restrict sales for human consumption, while online vendors market it as a research chemical. Such products may lack purity data, and their actual contents can differ from the label. Purchasing or possessing cardarine may carry legal consequences depending on jurisdiction. The compound is not a dietary supplement ingredient in regulated markets.
Clinical development stopped after rodent studies showed tumors at multiple sites. Whether those findings predict human cancer risk remains an open question, but they led sponsors to discontinue programs. Human safety data are limited to small, short-term studies that were not designed to assess cancer risk. Reported effects in those studies included changes in blood lipids, but the evidence is insufficient for medical use. Long-term consequences of nonmedical use are not well characterized. Questions about dose, duration, and individual susceptibility remain unresolved.
Cardarine is a common name for GW501516, an investigational compound developed in the 1990s for metabolic conditions. It acts as an agonist at peroxisome proliferator-activated receptor delta, a nuclear receptor involved in lipid and energy metabolism. The compound is frequently mislabeled as a selective androgen receptor modulator, or SARM, but its molecular target is different. GW501516 reached early clinical testing before development was discontinued. It has no approved therapeutic use in any country. The name cardarine is not a formal international nonproprietary name.
A study on Neanderthal teeth from the Chagyrskaya Cave in the Altai Mountains (Russia), indicating that the studied sample overall falls within the known Neanderthal phenotypic variability but also preserves specific morphological traits, is published by Gicqueau et al. (2026). Massilani et al. (2026) present a high-quality genome of an approximately 110,000-years-old Neanderthal individual from the Denisova Cave (Russia), providing evidence of a closer relationship of the studied individual to a 120,000-years-old Neanderthal from the same cave than to a 80,000-years-old individual from the Chagyrskaya Cave or to European Neanderthals, evidence of gene flow from Denisovans in both Neanderthals from the Denisova Cave, and evidence of differentiation between Altai and European Neanderthals comparable to that of the most differentiated populations of modern humans. Zubova et al. (2026) report evidence of deliberate invasive dental caries intervention in a 59,000-years-old Neanderthal molar from the Chagyrskaya Cave. Evidence from the study of rhinocerotid remains from Middle Paleolithic sites in France and Spain, interpreted as consistent with use of rhinoceros teeth as tools (including soft hammers and anvils) by Neanderthals, is presented by Sanz-Royo et al. (2026). Picin et al.
== Chemistry == Chemical constituents of the roots (Radix Astragali) include polysaccharides and triterpenoids (such as astragalosides), as well as isoflavones (including kumatakenin, calycosin, and formononetin) and their glycosides and malonates. It contains the saponin cycloastragenol.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
=== Cinema and cultural workers === In July 2024, the Karnataka Legislative Assembly passed the Karnataka Cine and Cultural Activists (Welfare) Bill, providing for a welfare framework for workers in the cinema and cultural sector. The legislation included a proposed 2 percent cess on movie tickets and OTT subscriptions and provided for a welfare board.
== Early life == Princess Zita of Bourbon-Parma was born at the Villa Pianore in the Italian Province of Lucca, 9 May 1892. The unusual name Zita was given to her after Zita, a popular Italian saint who had lived in Tuscany in the 13th century. She was the third daughter and fifth child of the deposed Robert I, Duke of Parma, and his second wife, Infanta Maria Antonia of Portugal, a daughter of King Miguel of Portugal and his wife Adelaide of Löwenstein-Wertheim-Rosenberg. Zita's father had lost his throne as a result of the movement for Italian unification in 1859 when he was still a child. He fathered twelve children during his first marriage to Princess Maria Pia of the Two Sicilies (six of whom were mentally disabled, and three of whom died young). Duke Robert became a widower in 1882, and two years later he married Infanta Maria Antonia of Portugal. The second marriage produced a further twelve children. Zita was the 17th among Duke Robert's 24 children. Robert moved his large family between Villa Pianore (a large property located between Pietrasanta and Viareggio) and his Schwarzau Castle in Lower Austria. It was mainly in these two residences that Zita spent her formative years. The family spent most of the year in Austria, moving to Pianore in the winter and returning in the summer. To move between them, they took a special train with sixteen coaches to accommodate the family and their belongings.
Sources: en.wikipedia.org
Several methods have been tested for their effectiveness at improving thorough intensive-care unit environmental hygiene. A study conducted in 2010 across 3532 high risk environmental surfaces in 260 intensive care unit rooms in 27 acute-care hospitals (ICUs) assessed the consistency at which these surfaces met base line cleaning standards. Only 49.5% of the high-risk object surfaces were found to meet this baseline criterion. The least-cleaned objects were bathroom light switches, room door knobs, and bed pan cleaners. Significant improvements in ICU room cleaning was achieved through a structured approach that incorporated a simple, highly objective surface targeting method and repeated performance feedback to environmental surface personnel. Specific methods included implementing an objective evaluation process, environmental surfaces staff education, programmatic feedback, and continuous training to minimize the spread of hospital-associated infections. The authors noted an improvement in the thoroughness of cleaning at 71% from baseline for the entire group of hospitals involved.
Classical MHC molecules present epitopes to the TCRs of CD8+ T lymphocytes. Nonclassical molecules (MHC class IB) exhibit limited polymorphism, expression patterns, and presented antigens; this group is subdivided into a group encoded within MHC loci (e.g., HLA-E, -F, -G), as well as those not (e.g., stress ligands such as ULBPs, Rae1, and H60); the antigen/ligand for many of these molecules remain unknown, but they can interact with each of CD8+ T cells, NKT cells, and NK cells. The oldest evolutionary nonclassical MHC class I lineage in humans was deduced to be the lineage that includes the CD1 and PROCR (also known as EPCR) molecules. This lineage may have been established before the origin of tetrapod species. However, the only nonclassical MHC class I lineage for which evidence exists that it was established before the evolutionary separation of Actinopterygii (ray-finned fish) and Sarcopterygii (lobe-finned fish plus tetrapods) is lineage Z of which members are found, together in each species with classical MHC class I, in lungfish and throughout ray-finned fishes; why the Z lineage was well conserved in ray-finned fish but lost in tetrapods is not understood.
=== Art history === In European pre-historic societies, sculptures of female figures with pronounced or highly exaggerated breasts were common. A typical example is the so-called Venus of Willendorf, one of many Paleolithic Venus figurines with ample hips and bosom. Artifacts such as bowls, rock carvings and sacred statues with breasts have been recorded from 15,000 BC up to late antiquity all across Europe, North Africa and the Middle East. Many female deities representing love and fertility were associated with breasts and breast milk. Figures of the Phoenician goddess Astarte were represented as pillars studded with breasts. Isis, an Egyptian goddess who represented, among many other things, ideal motherhood, was often portrayed as suckling pharaohs, thereby confirming their divine status as rulers. Even certain male deities representing regeneration and fertility were occasionally depicted with breast-like appendices, such as the river god Hapy who was considered to be responsible for the annual overflowing of the Nile.
== See also == Substituted methylenedioxyphenethylamine I Feel Love: MDMA and the Quest for Connection in a Fractured World Lykos Therapeutics Multidisciplinary Association for Psychedelic Studies (MAPS) Non-racemic MDMA and (R)-MDMA Carina Leveriza-Franz
== Function == Elastin, a protein in the extracellular matrix, provides elasticity and its soluble precursor is tropoelastin. When elastin cross links it produces desmosine and isodesmosine. When desmosine is mentioned, it is usually grouped with isodesmosine, the other tetrafunctional amino acid that is specific to elastin.
Sources: en.wikipedia.org
Yes, WADA prohibits cardarine as a PPARδ agonist. It appears on the prohibited list and can be detected in urine or blood. Athletes using it risk sanctions.
Detection usually uses liquid chromatography-tandem mass spectrometry after sample cleanup. Laboratories look for the parent compound or metabolites. The method requires validated reference standards and controls.
Legality varies by country. In many places it is an unapproved drug and cannot be legally sold for human consumption. Purchasing from online vendors carries legal and quality risks.
LC-MS/MS is common, often after sample cleanup. The assay targets GW501516 or its metabolites.